Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD49d

BD™ AbSeq Oligo Rat Anti-Mouse CD49d

Clone 9C10(MFR4.B)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Integrin α4; Itga4; Integrin alpha-4; LPAM alpha; VLA-4 alpha; VLA-4a
16401
2 µl
Rat LEW, also known as Lewis IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGTATGTAGCGTATGTTGGGATGCGTGTATGATTCG
AMM2132
Mouse (C57BL/6xA/J)F[1] Fetal Liver Mast MC/9
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940401 Rev. 2
Antibody Details
Down Arrow Up Arrow
9C10(MFR4.B)

The 9C10 (MFR4.B) monoclonal antibody specifically binds to the Integrin α4 chain (CD49d), which is expressed as a heterodimer with either of two β chains, β1 or β7. The α4β1 integrin (VLA-4, CD49d/CD29) is expressed on most peripheral lymphocytes, thymocytes, and monocytes; while the α4β7 integrin (LPAM-1) is expressed on peripheral lymphocytes, but on only a small subset of thymocytes. These integrins mediate a variety of cell-cell and cell-matrix interactions, recognizing the ligands VCAM-1 (CD106) and fibronectin. Integrin α4β7 also preferentially binds to the mucosal vascular addressin, MAdCAM-1. Although the 9C10 (MFR4.B) antibody alone has been reported to have little function-blocking activity, it can augment the inhibitory effects of mAb R1-2 (Cat. No. 553153), resulting in almost complete inhibition of VLA-4 binding to VCAM-1.

940401 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940401 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940401" on CiteAb

Development References (2)

  1. Kinashi T, Springer TA. Adhesion molecules in hematopoietic cells. Blood Cells. 1994; 20(1):25-44. (Immunogen). View Reference
  2. Springer TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell. 1994; 76(2):301-314. (Biology). View Reference
940401 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.