Skip to main content Skip to navigation
Hamburger Menu
Search icon
Order lookup icon Order lookup icon
Order Lookup
Country Selector Country Selector
United States (English)
Profile Icon Profile Icon
Sign-in/Register UserName
Products

Solutions

Discover & Learn

Resources & Tools

Support

Search icon Search icon
Close Menu
      Alert Icon
      Oligo Mouse Anti-Human CD34

      BD™ AbSeq Oligo Mouse Anti-Human CD34

      Clone 8G12 (also known as HPCA2)

      (RUO)
      Product Details
      Down Arrow Up Arrow


      BD™ AbSeq
      CD34; CD34 antigen; CD34 molecule
      947
      2 µl
      Mouse BALB/c IgG1, κ
      Human (Tested in Development)
      Single Cell 3' Sequencing (Qualified)
      ATGGTGGCTAGGAATTGCGCTGACGTATGTTTGGGT
      AHS0182
      Human KG-1a Cell Line
      Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
      RUO
      Mouse


      Preparation And Storage

      Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
      Show More blue down arrow Show Less blue up arrow

      Recommended Assay Procedures

      Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

      BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

      Show More blue down arrow Show Less blue up arrow

      Product Notices

      1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
      2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
      3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
      4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
      5. Illumina is a trademark of Illumina, Inc.
      6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
      7. Please refer to bd.com/genomics-resources for technical protocols.
      8. For U.S. patents that may apply, see bd.com/patents.
      Show More blue down arrow Show Less blue up arrow
      940264 Rev. 2
      Antibody Details
      Down Arrow Up Arrow
      8G12

      The 8G12 monoclonal antibody specifically recognizes CD34, a 105-120 kDa single-chain type I transmembrane glycoprotein. The 8G12 antibody recognizes an epitope on CD34 distinct from the one recognized by clone My10. CD34 is expressed on immature hematopoietic precursor cells and all hematopoietic colony-forming cells in bone marrow and blood, including unipotent (CFU-GM, BFU-E) and pluripotent progenitors (CFU-GEMM, CFU-Mix, and CFUBlast). The CD34 antigen is a differentiation stage-specific leucocyte antigen. Terminal deoxynucleotidyl transferase-positive B- and T-lymphoid precursors in normal bone marrow are CD34+. The CD34 antigen is present on early myeloid cells that express the CD33 antigen but lack the CD14 and CD15 antigens and on early erythroid cells that express the CD71 antigen and dimly express the CD45 antigen. The CD34 antigen is also found on capillary endothelial cells and approximately 1% of human thymocytes. Normal peripheral blood lymphocytes, monocytes, granulocytes, and platelets do not express CD34. CD34 density is highest on early hematopoietic progenitor cells and decreases as cells mature. The antigen is absent on fully differentiated hematopoietic cells. Uncommitted CD34+ progenitor cells are CD38- and lack lineage-specific antigens such as CD71, CD33, CD10, and CD5, while CD34+ cells that are lineage-committed express the CD38 antigen in high density. Most CD34+ cells reciprocally express either the CD45RO or CD45RA antigens, with the CD45RO+ population being the more primitive. Approximately 60% of acute B-lymphoid leukemias and acute myeloid leukemias (AML) and 1% to 5% of acute T-lymphoid leukemias express CD34. CD34 is not expressed on chronic lymphoid leukemias or lymphomas.

      940264 Rev. 2
      Format Details
      Down Arrow Up Arrow
      Antibody-Oligo
      The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
      Antibody-Oligo
      940264 Rev.2
      Citations & References
      Down Arrow Up Arrow
      View product citations for antibody "940264" on CiteAb

      Development References (17)

      1. Lansdorp PM, Dougherty GJ, Humphries RK. CD34 epitopes. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:826-827.
      2. Andrews RG, Singer JW, Bernstein ID. Precursors of colony-forming cells in humans can be distinguished from colony-forming cells by expression of the CD33 and CD34 antigens and light scatter properties.. J Exp Med. 1989; 169(5):1721-31. (Biology). View Reference
      3. Brocklebank AM, Sparrow RL. Enumeration of CD34+ cells in cord blood: a variation on a single-platform flow cytometric method based on the ISHAGE gating strategy.. Cytometry. 2001; 46(4):254-61. (Biology). View Reference
      4. Gore SD, Kastan MB, Civin CI. Normal human bone marrow precursors that express terminal deoxynucleotidyl transferase include T-cell precursors and possible lymphoid stem cells.. Blood. 1991; 77(8):1681-90. (Biology). View Reference
      5. Greaves MF, Titley I, Colman SM, et al. CD34 cluster workshop report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:840-846.
      6. Hurwitz CA, Loken MR, Graham ML, et al. Asynchronous antigen expression in B lineage acute lymphoblastic leukemia.. Blood. 1988; 72(1):299-307. (Biology). View Reference
      7. Kurtzberg J, Denning SM, Nycum LM, Singer KH, Haynes BF. Immature human thymocytes can be driven to differentiate into nonlymphoid lineages by cytokines from thymic epithelial cells.. Proc Natl Acad Sci USA. 1989; 86(19):7575-9. (Biology). View Reference
      8. Lansdorp PM, Sutherland HJ, Eaves CJ. Selective expression of CD45 isoforms on functional subpopulations of CD34+ hemopoietic cells from human bone marrow.. J Exp Med. 1990; 172(1):363-6. (Clone-specific: Flow cytometry). View Reference
      9. Lanza F, Moretti S, Papa S, Malavasi F, Castoldi G. Report on the Fifth International Workshop on Human Leukocyte Differentiation Antigens, Boston, November 3-7, 1993.. Haematologica. 79(4):374-86. (Clone-specific: Flow cytometry). View Reference
      10. Leary AG, Strauss LC, Civin CI, Ogawa M. Disparate differentiation in hemopoietic colonies derived from human paired progenitors.. Blood. 1985; 66(2):327-32. (Biology). View Reference
      11. Loken MR, Shah VO, Dattilio KL, Civin CI. Flow cytometric analysis of human bone marrow. II. Normal B lymphocyte development. Blood. 1987; 70(5):1316-1324. (Biology). View Reference
      12. Loken MR, Shah VO, Dattilio KL, Civin CI. Flow cytometric analysis of human bone marrow: I. Normal erythroid development.. Blood. 1987; 69(1):255-63. (Biology). View Reference
      13. Peschel C, Köller U. Cluster report: CD34. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:817-818. View Reference
      14. Ryan D, Kossover S, Mitchell S, Frantz C, Hennessy L, Cohen H. Subpopulations of common acute lymphoblastic leukemia antigen-positive lymphoid cells in normal bone marrow identified by hematopoietic differentiation antigens.. Blood. 1986; 68(2):417-25. (Biology). View Reference
      15. Siena S, Bregni M, Brando B, et al. Flow cytometry for clinical estimation of circulating hematopoietic progenitors for autologous transplantation in cancer patients.. Blood. 1991; 77(2):400-9. (Clone-specific: Flow cytometry). View Reference
      16. Terstappen LW, Huang S, Safford M, Lansdorp PM, Loken MR. Sequential generations of hematopoietic colonies derived from single nonlineage-committed CD34+CD38- progenitor cells. Blood. 1991; 77(6):1218-1227. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
      17. Terstappen LW, Safford M, Könemann S, et al. Flow cytometric characterization of acute myeloid leukemia. Part II. Phenotypic heterogeneity at diagnosis.. Leukemia. 1992; 6(1):70-80. (Biology). View Reference
      View All (17) View Less
      940264 Rev. 2

      Please refer to Support Documents for Quality Certificates


      Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


      Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

      For Research Use Only. Not for use in diagnostic or therapeutic procedures.