Skip to main content Skip to navigation
Hamburger Menu
Search icon
Order lookup icon Order lookup icon
Order Lookup
Country Selector Country Selector
United States (English)
Profile Icon Profile Icon
Sign-in/Register UserName
Products

Solutions

Discover & Learn

Resources & Tools

Support

Search icon Search icon
Close Menu
      Alert Icon
      Oligo Rat Anti-Mouse CD14

      BD™ AbSeq Oligo Rat Anti-Mouse CD14

      Clone rmC5-3

      (RUO)
      Product Details
      Down Arrow Up Arrow


      BD™ AbSeq
      Cd14; CD14 antigen; Myeloid cell-specific leucine-rich glycoprotein
      12475
      2 µl
      Rat LOU, also known as Louvain, LOU/C, LOU/M IgG1, κ
      Mouse (Tested in Development)
      Single Cell 3' Sequencing (Qualified)
      CAGCAATGGTAGTCACGTAGGGAGTTAATAGGGAGT
      AMM2070
      Recombinant Mouse CD14
      Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
      RUO
      Rat


      Preparation And Storage

      Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
      Show More blue down arrow Show Less blue up arrow

      Recommended Assay Procedures

      Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

      BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

      Show More blue down arrow Show Less blue up arrow

      Product Notices

      1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
      2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
      3. Please refer to bd.com/genomics-resources for technical protocols.
      4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
      5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
      6. Illumina is a trademark of Illumina, Inc.
      7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
      8. For U.S. patents that may apply, see bd.com/patents.
      Show More blue down arrow Show Less blue up arrow
      940174 Rev. 2
      Antibody Details
      Down Arrow Up Arrow
      rmC5-3

      The rmC5-3 monoclonal antibody specifically binds to residues 308-322 of the hydrophilic region of mouse CD14. CD14 is a 53-55 kDa glycophosphatidylinositol (GPI)-linked glycoprotein belonging to the leucine-rich glycoprotein repeat superfamily of cell-surface proteins. It is a receptor for the complex of lipopolysaccharide (LPS or endotoxin, from gram-negative bacteria) with LPS-binding protein (LBP, a plasma protein). CD14 serves as a receptor for LPS that can play a role in the cellular production of proinflammatory cytokines such as IL-1 and TNF. CD14 can be involved in the development of endotoxic shock and LPS-stimulated bone resorption, and promotes, possibly indirectly, bacterial dissemination. Flow cytometric analysis demonstrates that rmC5-3 antibody stains J774A.1 (mouse macrophage line), WEHI-265.1 (mouse monocytic line), peritoneal resident macrophages, Kupffer cells, and cultured bone marrow-derived macrophages and dendritic cells, but not unstimulated splenic macrophages, dendritic cells, neutrophils, or blood monocytes. This staining pattern is similar to that of the alternate anti-mouse CD14 mAb 4C1/CD14, which recognizes a different CD14 epitope, and differs from that of the human, where CD14 expression is characteristic of circulating monocytes and neutrophils. Therefore, data suggests that CD14 expression by leukocyte populations may differ in mice and humans. Peritoneal cells from naive mice, 3-day thioglycollate-elicited peritoneal exudate, as well as 4-hour LPS-activated peritoneal cells, contain a population of Mac-1 (CD11b)-high cells which double-stain with rmC5-3 antibody. Levels of CD14 expression on Kupffer cells and bone marrow-derived macrophages and dendritic cells of LPS-sensitive mice are increased by in vivo and in vitro LPS treatments, an effect which may be mediated by TNF. Preliminary evidence suggests that CD14 may be up-regulated on mouse blood neutrophils. In agreement with the observations that CD14 is shed from activated human and mouse monocytes, rmC5-3 mAb detects soluble CD14 in the serum of LPS-treated mice in a time-dependent manner.

      940174 Rev. 2
      Format Details
      Down Arrow Up Arrow
      Antibody-Oligo
      The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
      Antibody-Oligo
      940174 Rev.2
      Citations & References
      Down Arrow Up Arrow
      View product citations for antibody "940174" on CiteAb

      Development References (13)

      1. Fearns C, Kravchenko VV, Ulevitch RJ, Loskutoff DJ. Murine CD14 gene expression in vivo: extramyeloid synthesis and regulation by lipopolysaccharide. J Exp Med. 1995; 181(3):857-866. (Biology). View Reference
      2. Fearns C, Loskutoff DJ. Role of tumor necrosis factor alpha in induction of murine CD14 gene expression by lipopolysaccharide. Infect Immun. 1997; 65(11):4822-4831. (Biology). View Reference
      3. Ferrero E, Hsieh CL, Francke U, Goyert SM. CD14 is a member of the family of leucine-rich proteins and is encoded by a gene syntenic with multiple receptor genes. J Immunol. 1990; 145(1):331-336. (Biology). View Reference
      4. Haziot A, Ferrero E, Kontgen F, et al. Resistance to endotoxin shock and reduced dissemination of gram-negative bacteria in CD14-deficient mice. Immunity. 1996; 4(4):407-414. (Clone-specific: Flow cytometry). View Reference
      5. Mahnke K, Becher P, Ricciardi-Castagnoli P, Luger TA, Schawrz T Grabbe S. CD14 is expressed by subsets of murine dendritic cells and upregulated by lipopolysaccharide. In: Ricciardi-Castagnoli P, ed. Dendritic Cells in Fundamental and Clinical Immunology. New York: Plenum Press; 1997:145-159.
      6. Matsuura K, Ishida T, Setoguchi M, Higuchi Y, Akizuki S, Yamamoto S. Upregulation of mouse CD14 expression in Kupffer cells by lipopolysaccharide. J Exp Med. 1994; 179(5):1671-1676. (Immunogen: ELISA, Flow cytometry, Immunohistochemistry, Western blot). View Reference
      7. Miyata Y, Takeda H, Kitano S, Hanazawa S. Porphyromonas gingivalis lipopolysaccharide-stimulated bone resorption via CD14 is inhibited by broad-spectrum antibiotics. Infect Immun. 1997; 65(9):3513-3519. (Clone-specific: Immunohistochemistry). View Reference
      8. Nasu N, Yoshida S, Akizuki S, Higuchi Y, Setoguchi M, Yamamoto S. Molecular and physiological properties of murine CD14. Int Immunol. 1991; 3(2):205-213. (Biology). View Reference
      9. Pulendran B, Lingappa J, Kennedy MK, et al. Developmental pathways of dendritic cells in vivo: distinct function, phenotype, and localization of dendritic cell subsets in FLT3 ligand-treated mice. J Immunol. 1997; 159(5):2222-2231. (Clone-specific: Flow cytometry). View Reference
      10. Stewart CC. Methods for studying the ontogeny of monnuclear phagocytes. In: Weir DM, Herzenberg LA, Blackwell C, ed. Weir's Handbook of Experiemental Immunology. Blackwell Science Publications; 1986:44.1-44.17.
      11. Takakuwa T, Knopf HP, Sing A, Carsetti R, Galanos C, Freudenberg MA. Induction of CD14 expression in Lpsn, Lpsd and tumor necrosis factor receptor-deficient mice. Eur J Immunol. 1996; 26(11):2686-2692. (Clone-specific: Flow cytometry). View Reference
      12. Takamatsu S, Nakashima I, Nakano K. Modulation of endotoxin-induced histamine synthesis by cytokines in mouse bone marrow-derived macrophages. J Immunol. 1996; 156(2):778-785. (Clone-specific: Flow cytometry). View Reference
      13. Takezawa R, Watanabe Y, Akaike T. Direct evidence of macrophage differentiation from bone marrow cells in the liver: a possible origin of Kupffer cells. J Biochem (Tokyo). 1995; 118(6):1175-1183. (Biology). View Reference
      View All (13) View Less
      940174 Rev. 2

      Please refer to Support Documents for Quality Certificates


      Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


      Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

      For Research Use Only. Not for use in diagnostic or therapeutic procedures.