Skip to main content Skip to navigation
Oligo Rat Anti-Mouse Ly-6G

BD™ AbSeq Oligo Rat Anti-Mouse Ly-6G

Clone 1A8

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Ly6g; Lymphocyte antigen 6G; Lymphocyte antigen 6 complex, locus G; Gr1
2 µl
Rat LEW, also known as Lewis IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AACAATAGGGATGCGGGATAAGAATACGAAAGGAGT
AMM2009
Ly-6G-transfected EL4J Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940113 Rev. 2
Antibody Details
Down Arrow Up Arrow
1A8

The 1A8 monoclonal antibody specifically binds to Ly-6G, a 21-25-kDa GPI-anchored protein. In the bone marrow, Ly6G is expressed on the majority of the largest cells, predominantly granulocytes, but not on lymphoid or erythroid cells.  In the periphery, it is expressed on granulocytes. The mAb RB6-8C5 recognizes both Ly-6G and Ly-6C and blocks the binding of mAb 1A8 to Ly-6G.

940113 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940113 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940113" on CiteAb

Development References (3)

  1. Fleming TJ, Fleming ML, Malek TR. Selective expression of Ly-6G on myeloid lineage cells in mouse bone marrow. RB6-8C5 mAb to granulocyte-differentiation antigen (Gr-1) detects members of the Ly-6 family. J Immunol. 1993; 151(5):2399-2408. (Immunogen: Flow cytometry, Immunoprecipitation). View Reference
  2. Fleming TJ, Malek TR. Multiple glycosylphosphatidylinositol-anchored Ly-6 molecules and transmembrane Ly-6E mediate inhibition of IL-2 production. J Immunol. 1994; 153(5):1955-1962. (Clone-specific: Flow cytometry, Functional assay, Inhibition). View Reference
  3. Fleming TJ, O'HUigin C, Malek TR. Characterization of two novel Ly-6 genes. Protein sequence and potential structural similarity to alpha-bungarotoxin and other neurotoxins. J Immunol. 1993; 150(12):5379-5390. (Biology). View Reference
940113 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.