Skip to main content Skip to navigation
Hamburger Menu
Search icon
Order lookup icon Order lookup icon
Order Lookup
Country Selector Country Selector
United States (English)
Profile Icon Profile Icon
Sign-in/Register UserName
Products

Solutions

Discover & Learn

Resources & Tools

Support

Search icon Search icon
Close Menu
      Alert Icon
      Oligo Mouse Anti-Human CD326

      BD™ AbSeq Oligo Mouse Anti-Human CD326

      Clone EBA-1

      (RUO)
      Product Details
      Down Arrow Up Arrow


      BD™ AbSeq
      EPCAM; EGP; ESA; GA733-2; hEGP-2; KSA; M4S1; MIC18; MK-1; TACSTD1; TROP1
      4072
      2 µl
      Mouse BALB/c IgG1, λ
      Human (Tested in Development)
      Single Cell 3' Sequencing (Qualified)
      TTGAGCGTAAAGTTGCGTCCGGTAATTGAGTTGCGT
      AHS0089
      Breast carcinoma–associated mucin BCA-225
      Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
      RUO
      Mouse


      Preparation And Storage

      Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
      Show More blue down arrow Show Less blue up arrow

      Recommended Assay Procedures

      Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

      BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

      Show More blue down arrow Show Less blue up arrow

      Product Notices

      1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
      2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
      3. Please refer to bd.com/genomics-resources for technical protocols.
      4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
      5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
      6. Illumina is a trademark of Illumina, Inc.
      7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
      8. For U.S. patents that may apply, see bd.com/patents.
      Show More blue down arrow Show Less blue up arrow
      940084 Rev. 3
      Antibody Details
      Down Arrow Up Arrow
      EBA-1

      The EBA-1 monoclonal antibody specifically binds to human CD326. CD326 is an approximately 40 kDa type 1 transmembrane glycoprotein and adhesion molecule that mediates intercellular adhesive interactions. CD326 is also known as epithelial adhesion molecule (EpCAM), epithelial glycoprotein 2 (EGP-2), and epithelial surface antigen (ESA). The epithelial cells present in non-squamous epithelia and tumors derived from such cells show EpCAM expression. The normal epithelial cells reactive with anti-EpCAM antibodies are those present in the (lower) respiratory tract; the (lower) gastrointestinal tract; tubules in the kidney; the surface epithelium of the ovary; the exocrine and endocrine pancreas; secondary germ cells of telogenic hair follicles; and secretory tubules of sweat glands in the skin, whereas the epidermis is negative. In addition, all epithelial cells in the thyroid and epithelial cells in the thymus show EpCAM expression, while the outer cortex and Hassall's corpuscles have low expression. In the liver, only the bile ducts appear to be positive with anti-EpCAM antibodies. Non-squamous- carcinoma cells have high EpCAM expression; some squamous carcinoma cells. Tumors arising from non-epithelial cells, such as lymphoma, mesothelioma, neuroblastoma, and melanoma, do not express EpCAM.

      940084 Rev. 3
      Format Details
      Down Arrow Up Arrow
      Antibody-Oligo
      The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
      Antibody-Oligo
      940084 Rev.3
      Citations & References
      Down Arrow Up Arrow
      View product citations for antibody "940084" on CiteAb

      Development References (13)

      1. Braun S, Pantel K, Müller P, et al. Cytokeratin-positive cells in the bone marrow and survival of patients with stage I, II, or III breast cancer. N Engl J Med. 2000; 342:525-533. (Biology). View Reference
      2. Carlsten M, Bjorkstrom NK, Norell H, et al. DNAX accessory molecule-1 mediated recognition of freshly isolated ovarian carcinoma by resting natural killer cells. Cancer Res. 2007; 67(3):1317-1325. (Clone-specific: Flow cytometry). View Reference
      3. De Leij L, Helrich W, Stein R, Mattes MJ. SCLC-cluster-2 antibodies detect the pancarcinoma/epithelial glycoprotein EGP-2. Int J Cancer. 1994; 8:60-63. (Biology). View Reference
      4. Diel IJ, Kaufmann M, Goerner R, Costa SD, Kaul S, Bastert G. Detection of tumor cells in bone marrow of patients with primary breast cancer: a prognostic factor for distant metastasis. J Clin Oncol. 1992; 10:1534-1539. (Biology). View Reference
      5. Hardingham JE, Kotasek D, Farmer B, et al. Immunobead-PCR: a technique for the detection of circulating tumor cells using immunomagnetic beads and the polymerase chain reaction. Cancer Res. 1993; 53(15):3455-3458. (Biology). View Reference
      6. Latza U, Niedobitek G, Schwarting R, Nekarda H, Stein H. Ber-EP4: new monoclonal antibody which distinguishes epithelia from mesothelial. J Clin Pathol. 1990; 43(3):213-219. (Biology). View Reference
      7. Momburg F, Moldenhauer G, Hämmerling GJ, Möller P. Immunohistochemical study of the expression of a Mr 34,000 human epithelium-specific surface glycoprotein in normal and malignant tissues. Cancer Res. 1987; 47:2883-2891. (Biology). View Reference
      8. Naume B, Borgen E, Beiske K, et al.. Immunomagnetic techniques for the enrichment and detection of isolated breast carcinoma cells in bone marrow and peripheral blood. J Hematother Stem Cell Res. 1997; 6:103-113. (Biology). View Reference
      9. Patriarca C, Macchi RM, Marschner AK, Mellstedt H. Epithelial cell adhesion molecule expression (CD326) in cancer: a short review. Cancer Treat Rev. 2012; 38(1):68-75. (Biology). View Reference
      10. Stahel RA, Gilks WR, Lehmann HP, Schenker T. Third International Workshop on Lung Tumor and Differentiation Antigens: overview of the results of the central data analysis. Int J Cancer. 1994; 8:6-26. (Biology). View Reference
      11. Takao M, Takeda K. Enumeration, characterization, and collection of intact circulating tumor cells by cross contamination-free flow cytometry. Cytometry A. 2011; 79(2):107-117. (Clone-specific: Flow cytometry). View Reference
      12. Trzpis M, McLaughlin PM, de Leij LM, Harmsen MC. Epithelial cell adhesion molecule: more than a carcinoma marker and adhesion molecule. Am J Pathol. 2007; 171(2):386-395. (Biology). View Reference
      13. Yemul S, Leon Ja, Pozniakoff T, Esser PD, Estabrook A. Radioimmunoimaging of human breast carcinoma xenografts in nude mouse model with 111In-labeled new monoclonal antibody EBA-1 and F(ab')2 fragments. Nucl Med Biol. 1993; 20:325-335. (Immunogen: ELISA, Radioimmunoassay, Western blot). View Reference
      View All (13) View Less
      940084 Rev. 3

      Please refer to Support Documents for Quality Certificates


      Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


      Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

      For Research Use Only. Not for use in diagnostic or therapeutic procedures.