Skip to main content Skip to navigation
Oligo Mouse Anti-Human TCRαβ

BD™ AbSeq Oligo Mouse Anti-Human TCRαβ

Clone IP26 (also known as IP26A)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
alpha-beta T cell receptor, TCRAB, TRA@/TRB@; IP26A
6957, 28755
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTGCGTCGGATTATTAGTTCGGGTATTATGCGGTGC
AHS0078
Human T Cell Clone
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. This product is sold under license. Purchase of this product does not include rights to (i) incorporate this product into the purchaser's own products for resale to end-users, or (ii) use this product to conduct for-profit research for or on behalf of another party. For information on obtaining a license to this product for such prohibited uses, contact INSERM, 7 rue Watt, 75013 Paris. Telephone: +33 1 55 03 01 60. Facsimile: +33 1 55 03 01 18. Email: techtransfert@inserm-transfert.fr
  8. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  9. For U.S. patents that may apply, see bd.com/patents.
940074 Rev. 4
Antibody Details
Down Arrow Up Arrow
IP26

The IP26 monoclonal antibody specifically recognizes a monomorphic determinant on the αβ T-cell receptor (TCRαβ). The TCRαβ is a disulfide-linked 80 kDa heterodimer consisting of a 44 kDa α chain and a 37 kDa β chain. The TCRαβ is normally expressed on 50-70% of thymocytes and on a large fraction of mature T cells including greater than 95% of peripheral blood CD3+ T cells. The TCRαβ serves as a receptor for peptide antigens bound to MHC molecules. The IP26 antibody is mitogenic and useful for the flow cytometric analysis of TCRαβ+ T-cell subsets.

940074 Rev. 4
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940074 Rev.4
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940074" on CiteAb

Development References (5)

  1. Agrawal SG, Marquet J, Plumas J, et al. Multiple co-stimulatory signals are required for triggering proliferation of T cells from human secondary lymphoid tissue. Int Immunol. 2001; 13(4):441-450. (Clone-specific: Activation, Functional assay, Stimulation). View Reference
  2. Nikolova M, Marie-Cardine A, Boumsell L, Bensussan A. BY55/CD160 acts as a co-receptor in TCR signal transduction of a human circulating cytotoxic effector T lymphocyte subset lacking CD28 expression. Int Immunol. 2002; 14(5):445-451. (Clone-specific: Flow cytometry). View Reference
  3. Oettgen HC, Kappler J, Tax WJ, Terhorst C. Characterization of the two heavy chains of the T3 complex on the surface of human T lymphocytes. J Biol Chem. 1984; 259(19):12039-12048. (Biology). View Reference
  4. Ortonne N, Huet D, Gaudez C, et al. Significance of circulating T-cell clones in Sezary syndrome. Blood. 2006; 107(10):4030-4038. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
  5. van Dongen JJ, Lhermitte L, Böttcher S, et al. EuroFlow antibody panels for standardized n-dimensional flow cytometric immunophenotyping of normal, reactive and malignant leukocytes. Leukemia. 2012; 26(9):1908-1975. (Clone-specific: Flow cytometry). View Reference
940074 Rev. 4

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.