Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD117

BD™ AbSeq Oligo Mouse Anti-Human CD117

Clone YB5.B8

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
KIT; c-Kit; SCFR; PBT; Mast/stem cell growth factor receptor
3815
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGATTAGTTGTCGTTATAGGGAGTGCGTTCTTAGCG
AHS0064
Acute myelocytic leukemia blasts
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940051 Rev. 3
Antibody Details
Down Arrow Up Arrow
YB5.B8

The YB5.B8 monoclonal antibody specifically binds to CD117, which is also known as c-Kit, or Stem cell factor Receptor (SCFR). CD117 is a ~145 kDa type I transmembrane glycoprotein with tyrosine kinase activity. CD117 is present on hematopoietic progenitor cell subsets, thymocytes, mast cells, hepatocytes and histiocytes. CD117 serves as a cytokine receptor for steel factor (SLF), also known as stem cell factor (SCF), or mast cell growth factor (MGF). The interaction of CD117 and SLF is crucial to hematopoiesis, mast cell differentiation, melanogenesis, and germ cell development. The ability of the YB5.B8 antibody to block the binding of c-Kit ligand is still controversial.

940051 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940051 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940051" on CiteAb

Development References (5)

  1. Ashman LK, Buhring HJ, Aylett GW, Broudy VC, Muller C. Epitope mapping and functional studies with three monoclonal antibodies to the c-kit receptor tyrosine kinase, YB5.B8, 17F11, and SR-1. J Cell Physiol. 1994; 158(3):545-554. (Biology). View Reference
  2. Lerner NB, Nocka KH, Cole SR, et al. Monoclonal antibody YB5.B8 identifies the human c-kit protein product. Blood. 1991; 77(9):1876-1883. (Biology). View Reference
  3. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  4. Wypych J, Bennett LG, Schwartz MG, et al. Soluble kit receptor in human serum. Blood. 1995; 85(1):66-73. (Biology). View Reference
  5. Yarden Y, Kuang WJ, Yang-Feng T, et al. Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand. EMBO J. 1987; 6(11):3341-3351. (Biology). View Reference
940051 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.