Skip to main content Skip to navigation
Oligo Rat Anti-CD11b

BD™ AbSeq Oligo Rat Anti-CD11b

Clone M1/70

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Itgam; Integrin alpha-M; Ly-40; Mac-1a; Mac-1 alpha; CR3A; CR-3 alpha chain
3684, 16409
2 µl
Rat DA, also known as DA/HA IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATCGTTATTCGTTGTAGTTCGCCCGGTTTGAGTAGT
AHS0005
Mouse Splenic Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940008 Rev. 4
Antibody Details
Down Arrow Up Arrow
M1/70

The M1/70 monoclonal antibody specifically binds to CD11b, also known as Integrin alpha M (Itgam or αM). CD11b is a 170-kDa type 1 transmembrane glycoprotein and belongs to the Integrin alpha chain family. CD11b serves as the alpha chain of the heterodimeric Mac-1 integrin (CD11b/CD18, αMβ2), also known as complement receptor 3 (CR3). Mac-1 mediates adhesion to ICAM-1 (CD54), ICAM-2 (CD102), fibrinogen and binding to C3bi.  Mac-1 is expressed at varying levels on granulocytes, macrophages, myeloid-derived dendritic cells, natural killer cells, microglia, and B-1 B lymphocytes.  Mac-1 expression is rapidly upregulated on neutrophils after activation, in the same time period that CD62L (L-selectin) is shed from the cell surface.  The M1/70 antibody reportedly blocks cell adherence and C3bi binding but does not block cell-mediated lysis.  Cross-reaction of the M1/70 antibody with CD11b expressed on human monocytes, polymorphonuclear leukocytes, and NK cells has been reported.

940008 Rev. 4
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940008 Rev.4
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940008" on CiteAb

Development References (12)

  1. Ault KA, Springer TA. Cross-reaction of a rat-anti-mouse phagocyte-specific monoclonal antibody (anti-Mac-1) with human monocytes and natural killer cells. J Immunol. 1981; 126(1):359-364. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting, Radioimmunoassay). View Reference
  2. Beller DI, Springer TA, Schreiber RD. Anti-Mac-1 selectively inhibits the mouse and human type three complement receptor. J Exp Med. 1982; 156(4):1000-1009. (Clone-specific: Blocking, Inhibition). View Reference
  3. Driver DJ, McHeyzer-Williams LJ, Cool M, Stetson DB, McHeyzer-Williams MG. Development and maintenance of a B220- memory B cell compartment. J Immunol. 2001; 167(3):1393-1405. (Clone-specific: Flow cytometry, Immunofluorescence). View Reference
  4. Kaji K, Takeshita S, Miyake K, Takai T, Kudo A. Functional association of CD9 with the Fc gamma receptors in macrophages. J Immunol. 2001; 166(5):3256-3265. (Clone-specific: Fluorescence microscopy, Immunofluorescence). View Reference
  5. Kishimoto TK, Jutila MA, Berg EL, Butcher EC. Neutrophil Mac-1 and MEL-14 adhesion proteins inversely regulated by chemotactic factors. Science. 1989; 245(4923):1238-1241. (Biology). View Reference
  6. Lagasse E, Weissman IL. Flow cytometric identification of murine neutrophils and monocytes. J Immunol Methods. 1996; 197(1-2):139-150. (Clone-specific: Flow cytometry). View Reference
  7. Lub M, van Kooyk Y, Figdor CG. Competition between lymphocyte function-associated antigen 1 (CD11a/CD18) and Mac-1 (CD11b/CD18) for binding to intercellular adhesion molecule-1 (CD54). J Leukoc Biol. 1996; 59(5):648-655. (Clone-specific: Immunoprecipitation). View Reference
  8. Sanchez-Madrid F, Simon P, Thompson S, Springer TA. Mapping of antigenic and functional epitopes on the alpha- and beta-subunits of two related mouse glycoproteins involved in cell interactions, LFA-1 and Mac-1. J Exp Med. 1983; 158(2):586-602. (Clone-specific: Immunoaffinity chromatography, Immunoprecipitation, Inhibition). View Reference
  9. Springer T, Galfre G, Secher D, Milstein C. Monoclonal xenogeneic antibodies to mouse leukocyte antigens: identification of macrophage-specific and other differentiation antigens. Curr Top Microbiol Immunol. 1978; 81:45-50. (Immunogen: Immunoprecipitation, Radioimmunoassay). View Reference
  10. Springer T, Galfre G, Secher DS, Milstein C. Mac-1: a macrophage differentiation antigen identified by monoclonal antibody. Eur J Immunol. 1979; 9(4):301-306. (Clone-specific: Flow cytometry, Immunoprecipitation). View Reference
  11. Springer T, Galfre G, Secher DS, Milstein C. Monoclonal xenogeneic antibodies to murine cell surface antigens: identification of novel leukocyte differentiation antigens. Eur J Immunol. 1978; 8(8):539-551. (Immunogen: Immunoprecipitation). View Reference
  12. Springer TA, Davignon D, Ho MK, Kurzinger K, Martz E, Sanchez-Madrid F. LFA-1 and Lyt-2,3, molecules associated with T lymphocyte-mediated killing; and Mac-1, an LFA-1 homologue associated with complement receptor function. Immunol Rev. 1982; 68:171-195. (Immunogen: Immunoprecipitation, Radioimmunoassay). View Reference
View All (12) View Less
940008 Rev. 4

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.